MRNA sequence help.. how to find the mRNA sequence of a strand of DNA.?

What is the mRNA sequence of this strand of DNA.
TACGGTCTACGGTAGGTTCCGATT

Also, if you can, how did you find it? Having troubles!
Thanks
5 answers 5