How can I extract and sequence my own DNA on the cheap?

I want to find out what makes my genes so wonderful but I read that sequencing a genome is not easy. Is there some way I can do this using a basic chemistry set?

Update:

EDIT: Can I not use some basic chromatography technique? Is there not some dye solution which changes color when it comes into contact with a particular nucleotide?

7 Answers

Relevance
  • 9 years ago
    Favorite Answer

    Sequencing an entire genome or even a few hundred bases is difficult but extracting DNA for the basic reaction is pretty simple.

    Today the sequencing is done with all four bases read in one lane by a computer but historically 4 lanes with 4 reactions had to be done in order to read the base sequence. When I started sequencing a days read was 300 base pairs on a good day. The modern automated sequencers read runs of 900 base pairs in each lane.

    When I sequenced DNA in the early 90s it required radioactive p32 isotope labeling in the Sanger DNA polymerase extension method. Running the reactions on a gel, fix the gel in alcohol/acetic aid, transfer the gel to paper backing and drying, followed by exposure to X-ray film over night. The p32 labeled bands in 4 lanes can now be read from the film. Today chemiluminescents are used to label the reactions and a computer reads and distinguishes the 4 signals in a mixed lane.

    Read about the Sanger method & acrylamide gel electrophoresis

    http://biotech.about.com/od/pcr/a/sequencing.htm

    http://www.bio.davidson.edu/Courses/Molbio/MolStud...

    Autoradiography and Reading of Sequencing Gels

    http://cshprotocols.cshlp.org/cgi/content/extract/...

    Protocol hints

    http://www-lmmb.ncifcrf.gov/~pnh/FAQlist.html#Sect...

    DNA purification kit

    http://www.qiagen.com/products/genomicdnastabiliza...

    DNA sequencing kits like I once used are still sold at about $250 and are good for 100 reactions. In total this could give you 7, 500 base pairs, if you are good at it, out of the 3 billion in the genome.

    http://www.biocompare.com/ProductDetails/788759/Se...

    Sequencing apparatus

    http://www.mandel.ca/products/nucleic_acid_analysi...

    Gel dryer

    http://www.hitechtrader.com/dspManuals.cfm?CatID=2...

    Just having sequence does not tell you about the open reading frames and how to recognize exon boundaries. This requires a computer with the sequence homology analysis software like GCG Wisconsin package and enough computing power to operate it.

    http://docs.google.com/viewer?a=v&q=cache:zFga3tig...

    It would be much easier to just pay the $20,000 to Illumina and get it sequenced by professionals

    http://www.bio-itworld.com/news/06/03/10/Illumina-...

    Source(s): Then you could volunteer to make your genome public property and let it be part of the Personal Genome Project. It costs very little compared to the other options. http://www.personalgenomes.org/participate.html
    • Log in to reply to the answers
  • 9 years ago

    Well, I was going to say do it yourself, but once I saw the other answers I found out that's out of the question. That would be the cheapest way to go, I think. I mean, really if you had the knowledge, you could make some kind of machine out of raw materials and sequence it yourself.

    I did this experiment in biology class where we mashed up a strawberry, dropped it in some solution, and watched as the DNA was separated from the cells. I thought it was so cool to actually see DNA. Too bad we couldn't see it microscopically.

    But seriously, I don't think you understand the complexity and size of DNA. Your cells are extremely small. And your DNA is just this thin strand. To compare, a strand of hair measures 17E-6 to 180E-6 meters in width and DNA measures 2.2E-9 to 2.6E-9 meters in width. That's 7727 to 69230 times smaller. And the nucleotides are even smaller. You need a very powerful microscope to even see it. There is no dye that changes color when coming into contact with a certain base. The dye would be two big. Dropping it onto the strand under the microscope would, for one, move it out of focus, and two, the dye would be covering like 1000 bases and once. You would never be able to observe the changes in color. And plus, there are over 3 billion base pairs in the human genome. You can't sequence it all by yourself like that. You need a machine. Think about how a cell replicates itself almost automatically. Some kind of enzyme goes down the line and calls for the right protein. You need something automatic like that.

    • Log in to reply to the answers
  • Anonymous
    9 years ago

    Sure, you can sequence some of your own DNA at home. It takes a more than a basic chemistry set, but if you have some skill in the lab you'll be able to do it. (You don't though, do you? You're a troll who haunts "Religion and Spirituality," which is why you asked a question that couldn't be answered by specifying "on the cheap.")

    You'll need a centrifuge, a vortex mixer, a couple of micropipettes, a temperature-controlled warming plate or bath, and a gel electrophoresis apparatus. If you're handy you can make everything but the micropipettes yourself to save money. You'll also need lab supplies (3 mL test tubes, pipette tips, polyacrylamide gel, phosphate buffer), a PCR kit (detergent, protease, nuclease, polymerase, primers, deoxynucleotides, buffer), a supply of restriction enzymes, and some sequencing kits (polymerase, deoxynucleotides, dideoxynucleotides). (The sequencing kits will come with dyes, but since you're doing this manually at home you can do without them.)

    Harvest some cells, break them open with detergent and mechanical agitation, spin down the cell fragments and reserve the supernatant, destroy the RNA with nuclease then the nuclease with protease. Add primer, nucleotides, and polymerase, alternately incubate and cool for 30-40 cycles. Prepare as at least as many samples as you have restriction enzymes (more than 1 per enzyme is prudent), add one or more restriction enzymes to each sample and incubate. Separate each sample into at least 4 parts (again, it's prudent to have duplicates of each part). Add polymerase, deoxynucleotides, and a unique dideoxynucleotide (and dye, if you like) to each part. Incubate and cool each for 30-40 cycles. Prepare polyacrylamide gels with 1 of these parts per lane (unless you used dye) and separate the fragments electrophoretically. Dye the fragments (if they aren't already marked) and read the nucleotide sequence from the gel. Once you have the sequences for all fragments, use the fact that the restriction enzymes cut at different sites to reconstruct the original genome from the sequences of overlapping fragments created by cutting at different restriction sites.

    A PCR kit will cost about $75+/-, a Sanger sequencing kit good for 20 runs is about $100. The micropipettes are the most expensive item if you build the rest of the kit yourself.

    m

    • Log in to reply to the answers
  • Corey
    Lv 4
    9 years ago

    There isn't really a way to cheaply sequence your own DNA. You will have to find some form of polymerase and primers which aren't cheap. In addition you have to find a way to make the sequence a readable one, which isn't cheap or easy either. Our DNA doesn't have color codes and isn't labeled with letters, so you have to find a way to tell whether a base is a A, T, C or G. It has become much cheaper than it once was, especially with the discovery of taq polymerase.

    • Log in to reply to the answers
  • What do you think of the answers? You can sign in to give your opinion on the answer.
  • Linda
    Lv 4
    4 years ago

    It's quite simple really. You apply the T-A, G-U rule. In DNA, G always couples with C as a rule of thumb and T with A. In RNA C is replaced by U so that G couples with U in RNA. The sequence you gave therefore translates to: ATGUUAGATGUUAUUAAGGUTAA (mRNA sequence) TACGGTCTACGGTAGGTTCCGATT (DNA sequence)

    • Log in to reply to the answers
  • Anonymous
    9 years ago

    Gel electrophoresis is kind of like chromatography, and would allow you to compare your DNA to someone else's fairly cheaply. But as for sequencing your genome - that is seriously high tech. So - no, you can't.

    • Log in to reply to the answers
  • 9 years ago

    No, No there is not.

    Source(s): Good day to you.
    • Log in to reply to the answers
Still have questions? Get answers by asking now.